Hematological malignancy - PDFSEARCH.IO - Document Search Engine

Hematological malignancy
Results: 108

#	Item
41	Microsoft Word - Amyloidosis is Included this year.docx Add to Reading List Source URL: www.amyloidosissupport.org Language: English - Date: 2014-09-07 07:56:05 H. Lee Moffitt Cancer Center & Research Institute Hematology Hematological malignancy Leukemia & Lymphoma Society Moffitt Lymphoma Medicine Cancer organizations Oncology
42	U.S. Food and Drug Administration Notice: Archived Document The content in this document is provided on the FDA’s website for reference purposes only. This content has not been altered or updated since it was archived Add to Reading List Source URL: www.fda.gov Language: English Oncology Benzamides Alkynes Pralatrexate Pteridines Methotrexate Aminopterin Hematological malignancy Southern Research Institute Medicine Antifolates Lymphoma
43	Mayo School of Continuous Professional Development Mayo Clinic Acute and Chronic Leukemias 2014: A Case-Based Discussion Add to Reading List Source URL: www.mayo.edu Language: English - Date: 2014-06-17 13:09:08 Acute leukemia Myeloproliferative disease Myelodysplastic syndrome Acute myeloid leukemia Mayo Clinic Hematological malignancy Desert Ridge Chronic leukemia Oncology Medicine Myeloid leukemia
44	Study identifies gene network behind untreatable leukemia and possible treatment target Add to Reading List Source URL: medicalxpress.com Language: English - Date: 2014-11-27 13:03:55 Acute leukemia Acute myeloid leukemia Myelodysplastic syndrome Leukemia Hematological malignancy Acute eosinophilic leukemia Acute myeloid dendritic cell leukemia Oncology Medicine Myeloid leukemia
45	Blood Cancer Treatment – Making Informed Choices TRANSCRIPT WELCOME AND INTRODUCTION Lauren Berger, MPH [Slide 1 – Welcome and Introduction] Hello everyone. On behalf of The Leukemia & Lymphoma Society (LLS), a warm Add to Reading List Source URL: www.lls.org Language: English - Date: 2013-04-17 14:27:07 Myeloid leukemia Acute leukemia Stem cells Hematologic neoplasms Myelodysplastic syndrome Acute myeloid leukemia B-cell chronic lymphocytic leukemia Hematopoietic stem cell transplantation Hematological malignancy Medicine Oncology Lymphocytic leukemia
46	PDF Document Add to Reading List Source URL: www.northerncambria.com Language: English - Date: 2014-09-06 21:21:07 Leukemia & Lymphoma Society Light the Night Walk Lymphoma Childhood leukemia Leukemia Hematological malignancy Tee Medicine Oncology Cancer organizations
47	TGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGA AGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGA AGATGAAGCAGATGAAGCAG Add to Reading List Source URL: myeloma.uams.edu Language: English - Date: 2014-05-19 15:11:44 Immunosuppressants Stem cells Cancer organizations Multiple myeloma Hematopoietic stem cell transplantation University of Arkansas for Medical Sciences Multiple Myeloma Research Foundation Thalidomide Hematological malignancy Medicine Hematologic neoplasms Cancer research
48	ASHG » Membership » Obituaries and Memorials Gordon Wayne Dewald, PhD Dr. Gordon Wayne Dewald, 66, pioneering clinical cytogeneticist, researcher, teacher, and devoted husband, father, grandfather, and brother, died t Add to Reading List Source URL: ashg.org Language: English - Date: 2012-02-27 14:44:54 Cytogenetics Syndromes Myeloid leukemia Laboratories American College of Medical Genetics Medical genetics Myelodysplastic syndrome Fluorescence in situ hybridization Hematological malignancy Biology Medicine Genetics
49	Microsoft Word[removed]Research Grant Abstracts.doc Add to Reading List Source URL: a248.e.akamai.net Language: English - Date: 2013-08-21 11:31:10 Lymphoma Lymphocytic leukemia Carcinogenesis Hematological malignancy B-cell chronic lymphocytic leukemia Lymphoid leukemia NF-κB Myelodysplastic syndrome Multiple myeloma Medicine Oncology Hematologic neoplasms
50	Leukemia Research Foundation 2014 – 2015 Scientific Research Grant Recipients Page 1 of 3 NEW INVESTIGATOR AWARDS Add to Reading List Source URL: cdn.trustedpartner.com Language: English - Date: 2014-08-28 22:26:44 Myeloid leukemia Acute leukemia Immune system Acute myeloid leukemia Leukemia Myelodysplastic syndrome Childhood leukemia Hematological malignancy Carcinogenesis Oncology Medicine Biology

UPDATE